EST 418039 is a singleton


Sequence

>418039 (1 EST) Length=280 GGAGTATGTCGTTCTCTAGAAACTACATTTCCAGGATATCTGTTTGATGAATTGAATTGGTGCAATGGCAGTTTAACAGG CAACACAAAATACGGGACTGTATGTGGATGCGATTATAAAAGTAATGTTGTTCATGCGTTCTGGCAAAGTGCTTCGGCTG AGTATGCCAGGAGAGCATCTGGTAACATCTTTGTGGTACTGAATGGCTCGGTCAAAGCTCCATTTAATGAAAATAAAACT TTTGGAAAAATAGAACTACCATTGGTTAAAACATCCTCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 418039: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180391125928N20756SMNHADA008013SKSmAW


Date: 17:7:59 on Fri 24 Nov 117.