EST 418043 is a singleton


Sequence

>418043 (1 EST) Length=341 ATTCGGNACGAGNTAAGGCTGGAGCTTTCATGCATAGGATTGCTAAAATGTGATACTCAGTTTAAAATCTTTTATAATCG AGGTGACTTTCCTATTGCTTTGGAGCACGATAGCAAAGGAAACAAAATCGCATGGAAAGTGGAAATTGAAAAATTGGATN ACCACCATTATTNGCCACTATTNGGNGNAGGTCTAGCGGAAACTGAGCATCCATATGANTTCTTTGNAAGGCAAGGNGTC CATGATTTGNTTGCAACACGGAGGAAACAAAATCCTTCCTGTCANACCTCAACTTATANTTCCAATAAAGTCTGCTCTTA ACTTACGCCAGNACAANGNTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 418043: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180431125932N20760SMNHADA008021SKSmAW


Date: 19:6:9 on Thu 23 Nov 117.