EST 418044 is a singleton


Sequence

>418044 (1 EST) Length=383 GGCACGAGGACGAAACAGATATTGATGTAATGCGATATATGTCTCAGTTTGATTTGATCAAAAACTATGCTCAAATAAGA TCCGAAAATCAAAATCCAAACAGACTGAAAGGATCTAAAATTATCAGTTAATTTACGTCCGCCAGAAACCTGTTGGTTGT CAACTACTGCAAATGAATTCAGCACCNGTTACGAAAGGATTGTGAACACTAAATACATGAAGCTATGGTGGAACCTAATT TTATATGTGCGAAAANACATACAAAGGAGTTAGGCCACAAGGGAATNTCATCAATGGGAAGGAAAAGTATTCTCCGACTT CTTATTATTCAAGATGTATAGTTCAGNTATTATGCATTGTATCATAAGGAAAACCAGATGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418044: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180441125933N20761SMNHADA008022SKSmAW


Date: 17:26:16 on Wed 22 Nov 117.