EST 418045 is a singleton


Sequence

>418045 (1 EST) Length=420 TATGATATACCAATGCATCNTATTTTCTTTCTATTGCAGGGCGACCAAACATAAACTCTTTAGAGGAAGAAGAGCAAGCC CTATGTACACTAAGCTTACAGGATGACTCATAAGACTACTTTGTAAACTGACTCTTCCCGCTGTACTCTCGCGCACCGCG CTTTTTGATTTTGAAATAAAGAGGCTCATGATTCCCACAGTGTTCTCTCTTGGNGTGAAGTCCTCGTTTAACGTTGTGTG CTGTGCTGTTTTTCAGATCTGTACTGTTGGTTCTCTAACTGCTGATTCCACGTGTTTACACTAGACTCAACGGTAAATAC ATCTTCATATTTCTTGGTACCAGGAATTCGAATGTTACGCCAGCTAAACCATCAAAATGAAATTCATGAATGGAGTCGAT GGATATCATCAGCATGTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418045: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180451125934N20762SMNHADA008024SKSmAW


Date: 13:32:27 on Fri 24 Nov 117.