EST 418047 is a singleton


Sequence

>418047 (1 EST) Length=440 TTCACAGATGGTTGNCCATAGTTCATGCTGAAGCTAGTAGGCCAGTTAGAGTGATATTAAGAGGATATATAATGAAGTTA GGTATAGTAGGTGTACTTCGGGTGTGTAGTGGATGGCTAGNTAATGATNATGTATCTAGTGTAGTTGCAGCAATTTTTAT GGTNAGCTTAGTATTNATGTGNCGAGCTTATGCTGAAGTTGATCCTAAGCGNTGNATTGGCTGTTTTGAGTTTGTTACAT ATAGNGGTGAGGGTCGTCCATATCGATTTTCGGGTGANTACAGCCACAGANTTAGTTAGCCNGGNTGTNTTTCCATGGCT CATNGCTGNTCCTGTAAGTNCANCNCCTTATATCCNATATGCATGAGGNCNATNGGTGCATATTGGCCTCGANGGATGNT TAATTTTATCAACTGTATTTNGGTCAGCTATTTCCANTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 418047: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180471125936N20764SMNHADA008031SKSmAW


Date: 11:57:47 on Wed 22 Nov 117.