EST 418049 is a singleton


Sequence

>418049 (1 EST) Length=360 AATTCCANTAATTTATCTAGGGAAATCCTCTTCAGGAGCAGTTAGTTCTACTACAGGCAATACCACAAACGTTCTCATTT CTGAAAACAAACGTCCATCTGAGAGTAAGGAAACTTTATCTAAAGGTGAATACTATGTCCGAGAAAAGTGTTTTTACGAT CAGATAAGTAGGTCAGACGGACGACCAAGANGCCCTACCAACCTTCAGAGTGGNTGGAGAAANTATAAGAAATCAACAAN CAGTCATTATAATAGTGGTTTATCAACACGTGGGACGGANCATCTAATTCAAGCGGCACCATAGGTGGAAACAGNTGGAC TTCATTATCTAAAAGAGNAACGCCAATTGAATGTGGAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418049: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180491125938N20766SMNHADA008034SKSmAW


Date: 2:50:20 on Sat 25 Nov 117.