EST 418052 is a singleton


Sequence

>418052 (1 EST) Length=190 TGNACCTGGGGGCACCATCAANGCCATACGCGAACCCTACACTATCTCAAAGGGTCGTAAGTTCGAGAAAAGCTAGAGGT CGTCGTGCTAGTCGTGCTTACAAAAAGTAAAATTGTACATTAAAAATATACACTTGNTTGGATTCTTTCTGTTTGGGGTT TGTGGTTGGAATAAATTATCGATAATTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 418052: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180521125941N20769SMNHADA008038SKSmAW


Date: 0:17:44 on Sat 25 Nov 117.