EST 418054 is a singleton


Sequence

>418054 (1 EST) Length=340 TCATTTNATTGAGAACGAGGTGATAAATCACGTAGNAAAGTTATCATGAAAAGACAGTATTACTTAGNAAAATAGAATAA TTAAGATGCCAAACAATAAAAGTTTAAATGGATTGTTTTGGNTTTGGNAAAAATATAAAATATGAAATCATCGCGTGAAA GACACTTAGCTTGGATTAATCTAATAAGTAATATTNGGNTAGTCTCTGGATNCTGCTGTNCGGATTGCTACTGTGCGATT ATCAAATAGTGAAATCAGGTTGGTGAGTATGCCTTNGGCAANCAGATTAGANTCTATTGGTGTTATCTCCCACAGGATCC AATGCTCCCATAAGGATCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418054: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180541125943N20771SMNHADA008040SKSmAW


Date: 16:22:17 on Sun 19 Nov 117.