EST 418059 is a singleton


Sequence

>418059 (1 EST) Length=275 TTTANGTTTATNAGTCCTTGTAACATTAGTTTGTGTTGAAGCAACACCTGAAGTTGGTGATGAAATGCTACTGAAAAGAA TGGTACTAGATACTGCTGATAAACTCAAAATGTTAACTTTAAAACACATAGCCGCATGTCGTAATAAAGTGCAAACTTAT TTCAGGGNAAGGACGATCTAGGTGAGAAAATAGCAGACGTTTTAGTTGTTTTACTTAAACGTTTGGAATAAACGCCTAGN AAAATTGTTTAANATCATCTAATTTAGGAATAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418059: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180591125948N20776SMNHADA008049SKSmAW


Date: 17:49:18 on Mon 20 Nov 117.