EST 418065 is a singleton


Sequence

>418065 (1 EST) Length=381 ATTTGTCTAATGNAATAGTATGTAGTACAAAAATACCTCATATAATGTCAGCAACCAGTCGTACATTGTGTCAGTTTGAA AATACCAAAATTATAACTTACTGAAATGAAGTGCCTGTATTCACACTAACAATGTAGAAAGAAATTGAATGGAAATTCTT TTTTTTCTAATTCTCCTATTATCGTCATTATCTTTGNCTAATTACAGACTTGCTTTAATATGCATTCATTACAAATTATG TAAACTTTAATTAATAACTACCATATACATATAAATATAAGGTAATAATAATAATCTTATCAAATTATTAACAATATTNN NCCTATTCTTCTCTTCTAGGTTTATGAGTGCAANAAAATCTGGCGTGGNNGTCAACTCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 418065: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180651125954N20782SMNHADA008074SKSmAW


Date: 16:55:47 on Wed 22 Nov 117.