EST 418075 is a singleton


Sequence

>418075 (1 EST) Length=260 AGCGTTATTTGATCCCAGCTTCTTCTCAGATATATGTGTTGGAGTGGATGATGATTTTTTCCAGTCCTAGTTCATCCTAC AAAAATAGTTTGTNTTATTCACGACTCTTGTTATCACTACATATATGTACCATTTGTATCATGTTGACTAGCTNGATATC AGNGGTTTTACACCCCTTGCTACCATATCACTGCACATAANGGATATATATATATATATATATATATATNCAGNGCACTC ACCATAACTATTTCTTNATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 418075: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180751125964N20792SMNHADA008096SKSmAW


Date: 15:25:59 on Fri 24 Nov 117.