EST 418977 is a singleton


Sequence

>418977 (1 EST) Length=406 TCTATGCTTCTAATGAATTTAGAAACTCGTGCTGTTTGTNTTGAAGATATCGCTCGNCAAGTGCTTACATCTGATATGAA ACGTGCAACCAGAATATTGGGTTGATCAAATAGACAAAATAACAGAAAGTGANCTTCATGAAACTTCTTCATCGTATGAT TCATCGATGTAAACCAACATTAGTCGGTTTTGGACGAGTTGATAAACTACCATCACTTGAAGGATACTATTTCTCTGTTA AATAGCGANTCATATAAAGAGAGGAAATCAAAGTCAAGCANCCATCTCTAATATATTTANAGGGTTNATTTACNTTAATC TTTTTNACGGNTTTTCCCCCTTCTCTCTTTTTCATTCCCGCCCTCATTTGGTCATGTGTGCTTCTTCTTTATATGAGAAA CTCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418977: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4189771126864N21694SMNHADA009032SKSmAW


Date: 4:4:47 on Thu 23 Nov 117.