EST 418980 is a singleton


Sequence

>418980 (1 EST) Length=388 TAGCCGTAATTTCCCACTGCATACCAGTCGTTNGGGTTCAGTACCACCGCNAGCAGTTGGAACGTATCGTTCAACAATAA CTAGTACAGATTATGGATTGCCACCTGTTGTACATCGAAATTACAGAACAAATCGGTNTATTTATGAAACACCATATTAT NCAACTACATATAGTAATATTGAACCTATAAGNAACTACTTATACAAGTGTGGGCCCANGACGATACACATATTATTATC CATCAATTGTCACTACAAGGACCATTGTCGAGTNCAGGTTCCTATAGGTAACTTGTCTAGTGATATGCAAGGCTGAACGT TGACGATTTGGAAANTGGGCCGCCGGAACCACGGGTATGGGAAGGGGATTAGNTNTTTCCTGAAGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418980: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4189801126867N21697SMNHADA009050M13SmAW


Date: 17:37:34 on Mon 20 Nov 117.