EST 418986 is a singleton


Sequence

>418986 (1 EST) Length=224 AATAAGTGTTTAACACTCTTAATGGAACAAACTAAATAGAATAATGGGTTGTTGTTGTTGTTGTTGTCGTCTTTCTATTC CATTTAATTAATNGATTCAAACAATCATCGTCCTGTTTTGTGATCTCAGCCATTATGACACAATGTTGGTCTACATTAAC TNCCGAACTATNTATAGATATATATGTATGGGCTATAGGGGGNGATCTCACCCTNTTNCGCNGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 418986: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4189861126873N21703SMNHADA009070SKSmAW


Date: 18:11:37 on Fri 17 Nov 117.