EST 418992 is a singleton


Sequence

>418992 (1 EST) Length=320 GTGNGTGTNGGNTGTAAAGNCAGAAAAAGGTTCGAAAACATCTGACAAGTTTGNAAACTAAGTCAACAGTTCATAACATT AACTCACGCAATCGTAACACGCAAAGAATAATATGGACTGTCACTTATACGAAAGAATTCCTCAAATACTCTGCTTCTCT AGCTGCATTTGGCACCTTTTGNTGGTTTGCTAAGGGACACCCTTTCGCAATTATGTTTGCGTCACTACTAATCGGCTTAT ATGTATATTTNCAGAGTATTAACTCTGGATTTCGNATTTACTAACCAAAAATAGACACTATTCCNTACTGAATTTNGTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418992: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4189921126879N21709SMNHADA009085SKSmAW


Date: 8:42:53 on Mon 20 Nov 117.