EST 418994 is a singleton


Sequence

>418994 (1 EST) Length=163 TGGTTATNTCAATTTAACCCTATATTGAATTATCACCTTTAAGCAATTGTTACGTTTTTTCATTTCCATCTTCCCCTAAT TTTACTGTNAATATGAATGCTACAGGGTCTNCTAGTTGAATGAATTAGTATTTCCCTCTTTCCATTAATATCGGAANTAA NAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418994: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4189941126881N21711SMNHADA009093SKSmAW


Date: 1:26:0 on Sun 19 Nov 117.