EST 418995 is a singleton


Sequence

>418995 (1 EST) Length=274 CTCGGGGATTATGNTAAAAGTGNACTAAATATGTTAGGTGTGGAAGAAATTCACAACAGGTTGTTTTGCTCATGCACTAC AAAGTTACGTATTAACTTCATTACCTTTATCATGGGTTTATGATAAGTATAAGACAATTGCTGNAAAAGCACGTAGGAAA ATATCAATACNCTNTTCATCTGNGTTACAATCTCTATTGTTGTGTTCAACTNTCTTNCCGATACATATGTATNTCTTTTC GGATATCGAATTCTNAGATATTATTATTATGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 418995: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4189951126882N21712SMNHADA009095SKSmAW


Date: 2:53:47 on Tue 21 Nov 117.