EST 419016 is a singleton


Sequence

>419016 (1 EST) Length=540 ATATATTTTAGCGCCCTGGAGCATATGCCTTTAAATCTCAAAATNGNCATTTGNTCACACCGNGTACCATGTCAACAGCA ACAGCAGCAACANCAATATCATCAACCAAATTATTCTTTTCTTCATGGTTATCCCCAAGCACAATACCAACANCCACATN ATCATCAACAAACTCATTACGTTCATCAGTNTCANCCTCAAGCAGCTAAAACACTTCTAGGTTAGGTCTGCTTCAGGCAT CATTGGNATAGGNCCAAAATAATCATAATAATCCTGATGTNTTTAGACCATTATCTAGTGGAAACATTCGACAAATGTCC TATNGTTTGGTAGNCTATTCGCCATATTGTGTTGGTCCAATTACCATGTGGGGGTTCATTACCAGGGTTAGGTTTATTCG CTATGTGCCTATAGTGATTATCGGGCCTCAGATATTAATCAGGTACAGACGGTAAGAGTGATATCGCAAGGACATTTAGN GATNACAGGATGTATTGGNGGGGTTATTATTATGTTTTACATGGGCAATATTACAATCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419016: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190161126903N21733SMNHADA017004SKSmAW


Date: 6:9:16 on Fri 24 Nov 117.