EST 419023 is a singleton


Sequence

>419023 (1 EST) Length=170 CAAATAAAATTTATTATTCTTGCAGTGTCCGCATATGTCTCTATATACAGNAAGTGACAATTCAACGTTTATTTGAGTAT TTCAGTAAATGTGAATGTGTACATTTCTTGTGGTGAAAAATGTAATAGATCATTCCATTTATTTCATTGAAATAAACTTG CTTTAGTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419023: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190231126910N21740SMNHADA017022SKSmAW


Date: 11:59:54 on Thu 23 Nov 117.