EST 419025 is a singleton


Sequence

>419025 (1 EST) Length=342 TCAAAGTTTAGGTGTAGNATGTACAGGACCACGTATTAGGAATGCTGCACACTTGGTTTGGGGTGCTGTATTAGGACAGT CATTACTTGGCATAACAACTTTATTATGTTATGTACCAGTTTCATTGGGATCATTGCATCAATGCGGTGGTGTTGTTTTG CTTTCATCCTTACTCTGGTTTACTCATTGTTTACGTGCTGTTCCAAAATAAAAACTTGCTAACACTTTTTTTGTGGGAAG CAATTGCAACTTTTTTTCATCATCTCATTCATTTTCTAGATGTTCCATTATAATCATTGTCAATATAATCTTTATAAATA TAATGCACAAAGTATTCAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419025: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190251126912N21742SMNHADA017024SKSmAW


Date: 19:35:23 on Mon 20 Nov 117.