EST 419026 is a singleton


Sequence

>419026 (1 EST) Length=211 ACATTAATTTAATACATCTGNAATACAATTAACTATGAATTGATTCTNGGTGATGTTTGTTATACAACATATTTAGGAAA ATTTGTTTCTTTGAAACATACTTTCAACAATTAAATTGTTTCTAAGTTAGTAACACAATNATGAAATGAAGTGATTTACT ANGGAAATAGATGTTCACANTCACTGAATAATAAATACCCTCTGTTATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419026: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190261126913N21743SMNHADA017026SKSmAW


Date: 1:29:53 on Sun 19 Nov 117.