EST 419027 is a singleton


Sequence

>419027 (1 EST) Length=423 GTAACTACACAAACATTGTTTACAGGTGNAAGTGNAAAGGAAAATTTTTTTNTCATGNAAACACAAGATGGTCATAATCA NCANTCTTGAATTCTATTGGTTATCANCGGCGGAGCAATGTGTTTCTTTANAATCATNTCGNGATCATAATTTCTCTTTA TTAACCCCACTTCTTNTTTTTTCGAATCCATTTNTGGTTAATCATGTAGAAACGCACAGCTTATTTCATATTCTAAATTA GTCATTAGCTTGTTATGAATTTGGTNNATTTCATATTTACCCTAATAAAACTTTACTCAAGTTGNATCTATCTTATTTAT ATTAGCGGTCTGGTGGATCTTGGAATTTACATTTTCCCCTCTTTTTTTCACTGACAATAAANATTACCATCATATGTTTA TCCACAATGCCCTGATGGATTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419027: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190271126914N21744SMNHADA017028SKSmAW


Date: 14:38:30 on Fri 17 Nov 117.