EST 419029 is a singleton


Sequence

>419029 (1 EST) Length=415 CATCGATGAATAAGATTCTAGAGNCTGCTCCAAGTATATACAAGTGATATACAGTGTTTTACAAATTTGTAGTTAAGTTG AAAAAAGGTGTACTCATCTTCGTACACAAATGTGTGAAGGCAGCTGAAAAGTGGCTAACTGCAAGTAATTACCATGGTGG CGCTGAAATGACATTTTCAAGAATTCTGCAGAATAAATTTATTCCATCACACCATTAGTAGAAAGTTTATAGTGATTCAA TTGTAAGATTCGACGTTCTGCTATGATAACACGATAGGAACAAAACTAAATTCATNGGTTGTAAATACTGTGAANGCTTG AAAGTAGAATCCAACTAACAACAACTGGTAATTTGGTGCCTGTTAATGATTCCCCATCCAAATAACGACAGTGTCAGACA TATGCGAAAGATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419029: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190291126916N21746SMNHADA017031SKSmAW


Date: 4:27:3 on Mon 20 Nov 117.