EST 419030 is a singleton


Sequence

>419030 (1 EST) Length=163 TTATAACTCACTCCAAGTTTGCATTCATCTATACCTTGGTTAATTGATTGATTTACTGTNATCGGNNTACTTCCATAGAT TATTTTGTTTTCAAACATTACTTGTCATGAACTGTATTCATCATTTACGCATATAAAATAACTATTTCATAGAACTTGTT TGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419030: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190301126917N21747SMNHADA017032SKSmAW


Date: 13:24:25 on Wed 22 Nov 117.