EST 419036 is a singleton


Sequence

>419036 (1 EST) Length=430 AACACTAAACGAATTATATTTTATTGNATTGTATATGAGTAACTNATTNGAGTAAATATATAAACTTATCGTCTAGAGNA ATCCTTATAATCCTTCAATACTACTTAAATATTATTGNAACTATNGTGCATGTTGTGTCTATAATTATGCTATAGAGTNN GACTATTGGATAATAAACTTATTGTATACAGNAATGTTTATNTGGTAATTAACAATTTNANTTCTTTAATTACGTAATGA TGATTTTTTAATNCNTTAAAAATACATTGATGGTACATGCACATGATCTTCAGTGTTTATTGCATATCATATTTGGNGGT NACAAAAATNGTTCCCTTATTACTNACTTGGANTACTTACTGACTGACGCCTGNTACTCCCAATGGAGTATAGGGGGGGT GCCAACCCAAACATCCTCCAACTATTGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419036: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190361126923N21753SMNHADA017051SKSmAW


Date: 1:2:5 on Tue 21 Nov 117.