EST 419039 is a singleton


Sequence

>419039 (1 EST) Length=364 AGATATAGTATNTTATATGTATCTAGTTTATNGTTTATTACAAAGAGGTTTACGTTAACAGTGGAATTTTTTGTACAATA ATTATTGAGAACCCATTATTNGTTTTCGTATACGATGTTATTGCCTACTCCATTGTCGTTCATTTCAATATCCTTACTTC TCTNGGTGGTTCCGTTTCTTGAAATATGACAAGTTAGATTTATGTATTTATCCTACAATGTCTGCTTCATTANCTCACTT TTTCTACATTCTGTTAATCCCGGTTTTCATACATAAAGATTTNCTTTTAGTTNGTATACTGCATTACATGGATGTTAAGT ATTATCATTTAAATATAGCTACAAGTATGGGGTAACTACGCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419039: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190391126926N21756SMNHADA017064SKSmAW


Date: 6:21:3 on Thu 23 Nov 117.