EST 419041 is a singleton


Sequence

>419041 (1 EST) Length=315 AATNCGGNACGAGATCATTCTTATTTNTTTTTAAGCGATGTTTTTTGGTGTAATTAGCATCCTCAACACTNCATGAAGTT ATATTTGGTAACAAGGTCTTGTTATTTTAGACGTAATTTGTTAGACACTGAATTGATGGTTCCTCTTGATGTNCTCTCCT TTTCTCTGTTCATTTNNCTCAATTNGTCTTTATTTCCTTTNAGTCGNGATCTTTNCAAAGCAATAAGTATGTTGGNCAGT TAGAGAATTTCGTTTGGTTATTTTAAAGCTGTAACATGGCTGGGGAATATAAATATGGTTATGACACACAGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419041: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190411126928N21758SMNHADA017068T3SmAW


Date: 4:57:23 on Sat 18 Nov 117.