EST 419044 is a singleton


Sequence

>419044 (1 EST) Length=380 AATNCGGCACGAGATTAATTATACAATATACAATACCAGCTATCTATCCAACTGGAATATTCACCGGATGTCTTGGTTTA GTTACTACATGTTTAGGATTTCTTGGAATATGGAGAAAAATCAATATTTTTTATATTTNACATGTTATTGGNGGGNCCAT AGCAACAATAATTAACCTATGTATAGCTGTTGTNTCGGNTATCATTGATGACCAATTTTTTATTANTGCTAAAGAAGCCT NGAATACTACTATTAAATATNATTATGAGAAGAATGAATATGGAGATGAATTNGATAAATTACATATGACATNCTTCTGT NGGGGGGGTTAATNCATATGCTGANNCTAGAAAAGCTAAATTATTGATACCATATTCNGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419044: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190441126931N21761SMNHADA017075T3SmAW


Date: 12:56:46 on Sun 19 Nov 117.