EST 419049 is a singleton


Sequence

>419049 (1 EST) Length=621 CTAACTACAATGATAATGATGATGATGACAAGGAGAAGAGTGAAAAGACGATAAACAAAAAGCCTCATTTTCCTTCTACT TCATTATTCGACAGCAAAATGGTGACGATGATGACAGCAAAGACAATGATGCCTTCTACCGTAAGACGACGATTAAAGTC TGATCATAGGTTAAGAGGACAAAATCCAACCAGTACCTATCATANTTATCGAAATTTCTACAATAAAGGTATTAGGAATA ATTTATTGGAAATGTATACACAAACTACAACTTATTCATTACGGGAGTTGGAAACATCGTTTACCTGTACAGGTGGCATT TAAAACTCGTTAAACATCTTCCTTTCGACTGATAGATTTTTTTTTACAAAAAGCTGTGGGTNTTTAATTTATTTTTAGGT GGTAACTGTATTTTCTTCAAATCTGGTTNGGNTTGACGGTCAAATGCTATCCATGTGGGCTTAGGTAATTATACAAGGTT TTCCCTATGAACATGGACTTGATAAATAATGGGTNTCCCTATTGGTAACTAGATCCATGGATTTTTAGCAACCGATGGCA TCACTNGGGCNAAGTNTAATGTCAAGNGGGTCANGTAATGGGNANCANGTTTATTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419049: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190491126936N21766SMNHADA018003SKSmAW


Date: 19:14:45 on Fri 24 Nov 117.