EST 419054 is a singleton


Sequence

>419054 (1 EST) Length=291 AATGGNTAGATCCATCGATAATTGATGATTATATTTCGATTTATATATCTATATAGATCATCATTAATACAATTTCGANT TTTCGTAATTCGCTTATTTTGAAGATGGTTGGTTAACTAATTANTAGAAATAATTATAAATGAATAATAATAATATTTCT ATCATTATCTATGGTAACTAAATTAATTTTTGNGACTATGCAACAACAACAAAAATTCAAAGGTNTGCCCTGACAACTAT CCANTTTTTTTAAAAAAAATTTGTATATAAATAATTATTTATTTNGNCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419054: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190541126941N21771SMNHADA018017SKSmAW


Date: 0:26:33 on Sat 25 Nov 117.