EST 419059 is a singleton


Sequence

>419059 (1 EST) Length=496 TCAACATCATCATCATGNAACAACANCAGTGTGTCGGATCTATTTCTAACCTGTATTAAGCTTAATGTTCTGTTANGTTT AAGTGAATGTTTAGATAAAGATAAATCAATTCAGCTTGATTTAATACCAGAACATATTCTACTCATCTTAACACCATCTA ATTGTTTAACAATCTTTAAACAATATGAAAAAGATAAATNGCCTAATACTGATAGTAATCATAATGAAGTCATCTTGAAA GAGACTAATCTACAGTGTCTATTGGACGCATTACATATTCAATCTCATTCAATGAATGATAGTATAAATGATGTATTAAA ACAATTCTATGAAATTATTCAACATAATTATCAATCTAAAGAAATGATTATTTCTTTATTAAAATCTATTGCACCANCAG GATNGGATAACAATGTGTGGTGGCTAGGAATATGTTTATTTTTACCAACCCAATNCCATGGATGGACAATCCTCCATAAT TTTTCTTTTNCTTNNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419059: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190591126946N21776SMNHADA018030SKSmAW


Date: 20:47:13 on Wed 22 Nov 117.