EST 419060 is a singleton


Sequence

>419060 (1 EST) Length=151 CGATTCGGNTCGTGGTGCTTTCTATCTAGCGTAAGGAAAAAGAAGTACGCCNGTTGGAAGCTAAAAGACGTCGAATTGAC TTGGNCAACCGGATGCAAAGCTGTAATTACTCGATATAATTTATACTACTAAATAAAATAATCAGACATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419060: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190601126947N21777SMNHADA018034SKSmAW


Date: 15:19:44 on Thu 23 Nov 117.