EST 419127 is a singleton


Sequence

>419127 (1 EST) Length=201 GANCGATTTGTGTCAGANTTTTCTGAATTGGNGTAAGCACTAATCGTCTGGGTGGTTAACATAGGTTTTCGTAGCTGGGA CATCAACATCTGGGAACATGAATTCATAAATAATATAGAAAAAACAAATGTGTAATACTTAGTCGCAGGTTCGCCCTGTG TTAACACAGGTTGTGTAAAGGAAAATAATTCTCTCCTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419127: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191271127978N21845SMNHADA018066SKSmAW


Date: 6:46:31 on Sat 25 Nov 117.