EST 419134 is a singleton


Sequence

>419134 (1 EST) Length=355 AATATCATTGTTGGNGTTCCAATCCTTTGATTATTGAATTCATGAAACAAATGAAGTTTGGTGATGATTATCACCGTCTG GAAGGCTATTACATAAAAANTCTAATTCAAATTATTAGTGATGTTAAACCGACTGGACGAAATATTACTCCAGTTGNNTG GNAGGAAATATTTCANAATGGGTTTAGAGGNGATAAATCAGCAGNAANTCANGTGCTGGAAAGACTCAGATTGGNAATCT GTGATGAAAAATGTTACCAAAACAGGCTATAGAGTACTATCCTCAGCTGCTTGGNACCTGAATTACATTTCTTATGGCGA TGACTGGCGGTNACTACTATCACGTTGGATCCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 419134: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191341127985N21852SMNHADA018081SKSmAW


Date: 4:4:33 on Thu 23 Nov 117.