EST 419135 is a singleton


Sequence

>419135 (1 EST) Length=481 AATTTAAAGTAATTGAATTATCTGTAGCCTGCCTACTACTACTGATATTAAAATGAGTGTGAAAGGATTTTTTAAAAGTG TATNAAATTCTGGAGNAACAAGAAGAAGAAACTGGAACCACCGGGGCCACATCAACAACAACTTCATTGTCTGGTTCAGC TACAGCTGGAGTAAATAATTTCCTATCTGGTACATCAAAATTTCTTGATTCTGTTCAAACAAAAAAGAATGGTTTAATTA GTGATTTGGTCGAATAAACTAACGTCATTCAAAATGCCTGGCGAAACAGTCGACCAATGAGAGTGAAAAGAAAAAGAAAT CTAATAGTAATGATGATGATGACAGNTCTGCCAGTGGAATATGGAGATGATGGTGATCGTCCAATGTATGCAGAAGTAGC TCCAGTAGGAACGTCAAGTATCAGTTGGAAGTATAGACAGGNTGGCAGATGAAGATGCTGANCGACGTTAATCGGANTTC G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419135: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191351127986N21853SMNHADA018082SKSmAW


Date: 14:7:49 on Mon 20 Nov 117.