EST 419136 is a singleton


Sequence

>419136 (1 EST) Length=411 AAAANGTTGTACGACTGNGNANGTTTATTGAAGNAAGACGTTATTTTGGGTTGGTACGACAAAGGACCTTCAAAAAAATT CGTNTCTCGCGAGCTGAGTGCGAAAATACTGGCTCGTTGCTCTCCTATGGTGACATGGTTGCGACAAGCTGAAGAGGAAG AGTCAGAAAGTTCTGAGGAGGAGTCTGAAACGAATGGCCATACAATCACTCAACCTATTAATGGGTCAAACAACGCCAGT GTTCCTGCTACTAATGTAACGGATGATGAAGATGACGATGTGGACATAGATGCTATATAAAACGTCCCACCANAACGTGT TAAACTATTGAGCTACCANGCTTTAACTTGTCTCCGATTCCTCATTTATATGTTGTCATTTTCTAACAAATATATTCCTG GCTGGTAACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419136: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191361127987N21854SMNHADA018086SKSmAW


Date: 11:11:28 on Sun 19 Nov 117.