EST 419141 is a singleton


Sequence

>419141 (1 EST) Length=165 GAGGCCACAAGATCGAGGNGCACAAATGAAAACACATCATTGTTAACGGNCTAAACTATATTCTTCTACTTTCGATCACA ATATTGTCATAATCCGAGGCTTGTATTATTACTGATTATTGCTTATTACTTTCCATAGTAAATGTAAATGCTTTATTTAN NAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419141: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191411127992N21859SMNHADA018096SKSmAW


Date: 2:36:13 on Fri 24 Nov 117.