EST 419142 is a singleton


Sequence

>419142 (1 EST) Length=247 AACTGAACATGAAGGACGGAGACTCATCGGATACAGAAAATGATCCTCATTATGAACCGATTGTTCCATTGCCAAAACTT GTTGAGGTCAAGACTGGAGAAGAAGAGGAGCTTTGTATTTTCCTTCGACGTTGNCGTGCCTACCGTTATGTTGATAAAGC CTGGAAAGAACGTGGCGTCGGTGGAAGTTAAAGTTCTTGTACAACCTCGTACTATGCCTACAGATGCTGCACGCTTNGGA CCACGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419142: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191421127993N21860SMNHADA019001SKSmAW


Date: 4:3:10 on Thu 23 Nov 117.