EST 419144 is a singleton


Sequence

>419144 (1 EST) Length=264 GTTGAAAACGCATTCTTAAAAATGGCTGAGNAAGGATTCAAGNAAAATGCAACACCAGTTCAAAATATGTTGTCTTCTAC TGTACCAGTTAATAGTACACAACCTGTCAAAAAAAGTGGGGGTTGCTGTTAAATATTTCTTGATAATCTTGAATCTATCC ATCCTCAACTTTATTATGGTTTATTTCTATGTGATTGTGCGCTTATCAAAACAACTATTCATCTCTCATATTCTTCCTTC ATTACTAAACTTGTGATATTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419144: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191441127995N21862SMNHADA019003SKSmAW


Date: 5:46:14 on Sun 19 Nov 117.