EST 419153 is a singleton


Sequence

>419153 (1 EST) Length=206 TTCTTTCTCCATCCTCCTTGTATCTCTTTGTTGTTATATGCTTGTGTGTGTGCGGTATTTTTCACTNGGTCTTTTCTTCA AATATCATTGTCAAGTAGTACGTATCATGTATCCTTTNAAAACCTTTCGGTGGCAAAATAATGTTCCAAGGAAAAATAAG CACCTTTTTCTTACTGTTTTTATCATATGTAAATATCATGTTCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419153: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191531128004N21871SMNHADA019017SKSmAW


Date: 6:13:15 on Sun 19 Nov 117.