EST 419154 is a singleton


Sequence

>419154 (1 EST) Length=296 AAAGAAGTTTACTTGGACCGACAGATTTTGGAAGTTGGCTTAAGTGTTGGTCATTTAGCTAGTCTATACAATTACGATAT GGATCGATTTAAAGAAGCTGAACAATTGTATTTACGTTCTGTACAAATTAGTTTAAATTTATTTGGTCCTACATATAGTG GTTTAGAATATGATTATCGTGGTTTACAACGTGTTTATCATGAAATTAGGTAATTATTCAGAAATGCAACGTTATCAAGG TTTATTTGNTTATTGGTCTAAAGAAAGACAACGCCTTCGCTCATTAGAACCATGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419154: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191541128005N21872SMNHADA019019SKSmAW


Date: 0:26:11 on Fri 24 Nov 117.