EST 419155 is a singleton


Sequence

>419155 (1 EST) Length=235 AATTGTCCATTGCTTTCTTAGCATCAGTTTGATCGTGTCAACTACCAGATAGGGATGTGAAGCTATGTCAGCTCCTCTCT CTCTCATGTTTTTCATGTCTTCCATTGACCTTCTGAATTTTCTAGTGATACAAATATAATTAGCCTGAAATTATTCTGTA GCTAACGGTAATTGTATAATATTTTAATGACATAGTTTAGTAAATATACATTGTAATGTTGTTTAATATTAATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419155: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191551128006N21873SMNHADA019020SKSmAW


Date: 1:52:54 on Sat 18 Nov 117.