EST 419156 is a singleton


Sequence

>419156 (1 EST) Length=283 ATGATTTAGTCATTATCCAGACCATGCCAGTAAATCACTCTTCGTTACGTTCAACATCATCAAAAGGTTCCAGTCCATNT AAACGACGTCATCCTCGAAGTTTAATACATGTTCCATTAAGTGGAGATCTAAATTGGACAGAGGAAATGTTTTGGACATT GAACAATTGTAACAATAACAATAATAGTACAATAACAACAAAATCCACGTCTATTACTACTACTCCTAATAAAAGTGTCT ACTCCCCTTCATCACCGNATAAAATAAATTCATCTTTTCGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 419156: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191561128007N21874SMNHADA019021SKSmAW


Date: 11:46:29 on Wed 22 Nov 117.