EST 419157 is a singleton


Sequence

>419157 (1 EST) Length=345 TCACTTAAGTGTTTTGGGGTCATATTGNAACTCTTTTTCAACGNTTTACAATATTGATCAGGATGACAAAAATATTTTAC TAATATTTTATCATACTACTACAACTATTTGNCTGAACACCGATAAGCAATTATCCTGTTTTAAATAACTAATATTTCAG AATCATCATATGTATTCTGAATCTCTCCTAATTCATTTGGTTCTACATTATTGTCTAATAATTTCTATCCTTGAAATGAA CTATGAAACATTCATTGGATCTCATTTAAATCACAAATTGACAGGCATAAAACTTTATTTAGCAAGGATTCACTTCAGNG GTTTTTATAAGACAATATATTATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419157: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191571128008N21875SMNHADA019022SKSmAW


Date: 8:48:41 on Mon 20 Nov 117.