EST 419159 is a singleton


Sequence

>419159 (1 EST) Length=154 AACCCTTTGGNTACTGCTGCAGCTGCTCCTAGACCATAAGTATACCCTTGNTATCCATATTGTAATTCTGACATGTTTTA TAAATAAATCTGAACTAATGTTTTATTTATTTAAAGCATTATTCGTTCTGAAATATATCTAACGTTCTCAGTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419159: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191591128010N21877SMNHADA019026SKSmAW


Date: 4:25:0 on Wed 22 Nov 117.