EST 419160 is a singleton


Sequence

>419160 (1 EST) Length=293 AAAATTGGGTGGTAGTGGTATTTGTTGTCCAATCACCTAATGGTTCCAAATATCCATGTGGTGGTCCAGGTCAAGGTTTT ATTTGCCTCAAGTGAAGGAGGATTTTGATAAATGTCGTGGTTTTCATCAAGCTCTTGAAGGATTTTGTTCTTTTCCCGGT GACAATTCAACTTATTCATTTATGCATAATAAAGTACATAATGTAGTGAGTGGTACATTTTGTTGTGCAGCTACTTCACC CAATGATCCTCTATTCTTAGTACATCATACACAAATTGGATAGGAATTTTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419160: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191601128011N21878SMNHADA019028SKSmAW


Date: 16:4:16 on Tue 21 Nov 117.