EST 419164 is a singleton


Sequence

>419164 (1 EST) Length=191 CAAATTTGGGGCCACATCCATTGTCATTGTAAAAGANTTAATNCACAGANCAGGATTAATANCAGANTANTTGTGATGAA CATGTGGGAATGAGAAGAAATGATNCACATTTCATTTGTTTAGATTAATAGTTTGGATAAAACCGGNATGAGAAAAGAGG TTGCCAACCGTGAAAAAAGACCACATGTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 419164: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191641128015N21882SMNHADA019033SKSmAW


Date: 14:24:32 on Fri 17 Nov 117.