EST 419168 is a singleton


Sequence

>419168 (1 EST) Length=277 AAAAACTAAATGCCGAATCATTATCTATAGGTTCTCGGTGTGAAGTTCGGATTCCTGGTCAACCGACAAAACGAGGTGTA ATAGAAATTTGTTGGCCAAACCAAATTTAAACCTGGTTATTGGGTCGGGGGTTCGTTATGATGAACCTTTAGGAAGGAAA TGACGGGAGTATTGATGGAGTACGATATTTTCAATGTCCAGAAAAGTATGGTGCATTTGGTAAAACCACAATGTGTTGGA GGCTGGTGGACTTTTCCCTGAACTTGGGTATTGGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 419168: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191681128019N21886SMNHADA019043SKSmAW


Date: 21:41:29 on Mon 20 Nov 117.