EST 419173 is a singleton


Sequence

>419173 (1 EST) Length=267 TATATTNCTTCAAATATTTAGGACTTTATTGGATTGACGGATCTTTTTTTTTGGGAGCACAAATATACGTGTTAACCATT GCTTCTTTATTAAAAAAAAACTTTTATTTTTCAGTGTTAGTCTTAAGAAGATATAAATATTGTAAAATNTNGGACAATCT AGTGGTTTTCGTCATTTATTTAAATGGTTTCTGGTNCTTTTCTAGTCTGAAAATTGTNCTTTTNNTTCAAAATGGTTAAG ACATAAATAATAAAATNCGGATGGACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419173: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191731128024N21891SMNHADA019049SKSmAW


Date: 8:40:52 on Mon 20 Nov 117.