EST 419176 is a singleton


Sequence

>419176 (1 EST) Length=240 AATGTATGGATTATTGGATTTGTTCATTTTTTCAATGTCTATCCTTTTTCTTATTTAATTTAATCATCATAATTAGTAGT TTTGGTTAGTAGTCTATNACTCTTCTTTATCTATTTCGGGTGGATGAATGAATTGACTTTTTAAACTAAAGAAATTGAAT GTTCATTCATTCATTCATTATACTTTATGGTTATGTATTAGGTTGATGATTATGTAGGATCTACTCCCTTCTTTCTTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 419176: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191761128027N21894SMNHADA019054SKSmAW


Date: 7:14:8 on Mon 20 Nov 117.